| NCBI Gene | ![]() |
|---|
| Relationships |
|---|
| The mRNA, XM_017384212.1, is a part of gene, LOC108212488. |
| The genetic_marker, MK008150 3_26675087, is located in gene, LOC108212488. |

| Name | Description |
|---|---|
An orange, doubled-haploid, Nantes-type carrot (DH1) was used for genome sequencing. We used BAC end sequences and a newly developed linkage map with 2,075 markers to correct 135 scaffolds with one or more chimeric regions. The resulting v2.0 assembly spans 421.5 Mb and contains 4,907 scaffolds (N50 of 12.7 Mb), accounting for ∼90% of the estimated genome size of 473 Mb. The scaftig N50 of 31.2 kb is similar to those of other high-quality genome assemblies such as potato and pepper. About 86% (362 Mb) of the assembled genome is included in only 60 superscaffolds anchored to the nine pseudomolecules. The longest superscaffold spans 30.2 Mb, 85% of chromosome 4. There are a few different naming schemes for this assembly. First there is the Phytozome genome ID 388: The authors' sequences and gene predictions were also submitted to Phytozome, and can be accessed at this address: https://phytozome-next.jgi.doe.gov/info/Dcarota_v2_0 LNRQ01: These sequences were then assigned GenBank accession numbers starting at LNRQ01000001.1 which corresponds to DCARv2_Chr1, up to LNRQ01004826.1 which corresponds to an unincorporated contig, DCARv2_C10750146. These reside in bioproject PRJNA268187, which is a subproject of umbrella project PRJNA285926. Assembly GCA_001625215.1: The genome assembly was later defined an accession number GCA_001625215.1 for assembly ASM162521v1 which consists of only the 9 chromosome sequences and the plastid assembly, which have accession numbers from CM004278.1 to CM004286.1 for the chromosomes and CM004358.1 for the plastid. The mitochondrial genome was not included because it is classified as an incomplete sequence. RefSeq: The assembly was then later added to RefSeq, and there another new set of identifiers was defined from NC_030381.1 to NC_030389.1 for the chromosomes, and from NW_016089425.1 to NW_016094239.1 for unincorporated scaffolds and contigs. These reside in bioproject PRJNA326436. Note that NCBI substituted different assembled organellar genomes from different genotypes for the RefSeq records. The NCBI Sequence report lists the correspondences between the various naming methods Link to the LNRQ01000000.1 master record at NCBI Raw Reads: Link to SRA accessions used for the genome assembly This genome is available in the CarrotOmics Blast Search | |
The RefSeq genome records for Daucus carota subsp. sativus were annotated by the NCBI Eukaryotic Genome Annotation Pipeline, an automated pipeline that annotates genes, transcripts and proteins on draft and finished genome assemblies. This report presents statistics on the annotation products, the input data used in the pipeline and intermediate alignment results. View the full report at https://www.ncbi.nlm.nih.gov/genome/annotation_euk/Daucus_carota_subsp._sativus/100/ Data from this analysis can be viewed in JBrowse here. |

| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| XM_017384212.1 | XM_017384212.1 | mRNA | DCARv2_Chr3:26674183..26675236 |
ATGACGAATCTTGCAAAATTAGAGTTCGTTGCCTTGGATGTCTCTGGAAA
TAATTATCTATCATGGGTCCTTGATGCGGAATTACACCTTAGTGCTAATG
GCCTAAAAGATACTATTGACCCAAAAAAAATCCCAACCGTTGAACAAAAT
GCGAAAGCAATTATCTTTCTTAGACATCACATCCACGAAGACCTAAAATC
TGAATACCTCACTATCAAAAATCCACTCACCCTTTGGAATAATCTTAAAG
ATAGATTTGATCACCAGAAACTTGTTCACTTGCCATCCGCCCGATATGAC
TGGATTAATTTGAGGCTACAGGATTTTAAATCTGTAGCTGAATATAATTC
AGCTCTTTTCAAGATAAGCTCAAAATTAATTTTATGTGGTGAAAATATTA
CCAATGCTGAAATGATTGAAAAGACCCTCTCAACCTTTCACCCCAACACT
ATGATCCTAGCTCAACAATATAGGGAGCGGAATTTTCAGAAATATGGTGA
GCTGATATCTCTCCTTCTTGTGGCTGAAAAGAATAATGAGTTGCTATTGA
AAAACCATCAGATACGTCCCACAGGCTCTGCCCAGTTACCTGAAGTACAC
AACACGTCATTCCTGAAGAATGAACGTGGGAAAGGGCATAGAGGAGGACG
AGGTTATGGACGAAACCGTGGACGTGGAAATTTCCGTGGTCGGTTTCGCA
ATCAATATCATTCTGGTCACCTGAAGTGGCAACGAGATGGTTACAACTCT
GGCCACCAGAAGTGGCAACGTGATGGTTACAACAAGTGCCAACGTGAAGT
GCCAAATAAAGGAAAGGCACCCCAAGAAGGAGAGAAACGAGACATATGTC
ATAGGTGCGGAACTGAGGGACACTGGCAACGTACTTGTCGTACACCCAAA
CATCTTGTTGATCTCTACGAGTCATTCAAAAAGAATACTGGAAAGAGAGT
GGAAACAAACTTTGCTAATTATAATCTAGTTAAGGAACCAGTCAACAAGA
CCTCAAATGAAATAGATACTGGTGCTAACCTTTATTATGGTTTAGACGAC
TAG