Resource Type:
Genetic Marker
Name:
MK003087 K0531
Identifier:
MK003087_K0531
Organism:
Marker Type:
SNP
Publication:
- Iorizzo M, Ellison S, Senalik D, Zeng P, Satapoomin P, Huang J, Bowman M, Iovene M, Sanseverino W, Cavagnaro P, Yildiz M, Macko-Podgórni A, Moranska E, Grzebelus E, Grzebelus D, Ashrafi H, Zheng Z, Cheng S, Spooner D, Van Deynze A, Simon P. A high-quality carrot genome assembly provides new insights into carotenoid accumulation and asterid genome evolution.. Nature genetics. 2016 06; 48(6):657-66.
- Cavagnaro PF, Iorizzo M, Yildiz M, Senalik D, Parsons J, Ellison S, Simon PW. A gene-derived SNP-based high resolution linkage map of carrot including the location of QTL conditioning root and leaf anthocyanin pigmentation.. BMC genomics. 2014 Dec 16; 15:1118.
- Parsons J, Matthews W, Iorizzo M, Roberts P, Simon P. Meloidogyne incognita nematode resistance QTL in carrot. Molecular breeding. 2015; 35(5).
- Parsons Joshua D. QTL for Meloidogyne incognita root knot nematode resistance and other traits of interest in carrot (Daucus carota). Ph.D. Thesis. 2014. University of Wisconsin-Madison
Relationship:
| Relationships |
|---|
| The genetic_marker, MK003087 K0531, is adjacent to primer, K0531_X. |
| The genetic_marker, MK003087 K0531, is adjacent to primer, K0531_Y. |
| The genetic_marker, MK003087 K0531, is adjacent to primer, K0531_Common. |
| The genetic_marker, MK003087 K0531, is adjacent to gene, DCAR_016873. |
| The genetic_marker, MK003087 K0531, is located in gene, LOC108223908. |
| The marker_locus, K0531, is an instance of genetic_marker, MK003087 K0531. |
MapViewer Marker Map Positions:
| Map Name | Linkage Group | Position | Locus | MapViewer |
|---|---|---|---|---|
| 2016 70349 NG full map | Chr5 | 46.806 | K0531 | MapViewer |
| 2014 J.Parsons Th. HM3 | Chr5 | 11.029 | K0531 | MapViewer |
| 2015 Br1091×HM1 | Chr5 | 13.219 | K0531 | MapViewer |
| 2016 80592 NG full map | Chr5 | 13.219 | K0531 | MapViewer |
| 2015 SFF×HM2 | Chr5 | 18.757 | K0531 | MapViewer |
| 2016 Integ NG bin map | CH5 | 21.774 | K0531 | MapViewer |
| 2015 HM3 | Chr5 | 11.029 | K0531 | MapViewer |
| 2014 J.Parsons Th. Fig_3.5 | Chr5 | 16.096 | K0531 | MapViewer |
| 2014 J.Parsons Th. Fig_2.4 | Chr5 | 16.096 | K0531 | MapViewer |
| 2014 J.Parsons Th. Br1091×HM1 | Chr5 | 13.219 | K0531 | MapViewer |
| 2014 70349 | Chromosome_5 | 46.806 | K0531 | MapViewer |
| 2014 J.Parsons Th. SFF×HM2 | Chr5 | 18.757 | K0531 | MapViewer |
| 2016 Integ NG full map | CH5 | 22.234 | K0531 | MapViewer |
| 2016 70349 NG bin map | Chr5 | 46.806 | K0531 | MapViewer |
| 2014 J.Parsons Th. Fig_4.4 | F2_Chr5 | 14.683 | K0531 | MapViewer |
| 2015 MB Merged | Chr5 | 16.096 | K0531 | MapViewer |
Synonyms:
- MK003087
Sequence Coordinates:
DCARv2_Chr5:8614051..8615973+
View location in JBrowse:
Sequence:
CGTCCATTCTTACAAGATAAGTGGCACGATTGCCCTASTCAGCTGGACCA
TGATATTGCTCCTGATGATCT
Sequences:
>MK003087_K0531 ID=MK003087_K0531; Name=MK003087 K0531; organism=Daucus carota; type=genetic_marker
CGTCCATTCTTACAAGATAAGTGGCACGATTGCCCTASTCAGCTGGACCA
TGATATTGCTCCTGATGATCT
This is the primary representative sequence for this feature.
Sequence Length:
71
Five Prime Flanking Region:
CGTCCATTCTTACAAGATAAGTGGCACGATTGCCCTA
Three Prime Flanking Region:
TCAGCTGGACCATGATATTGCTCCTGATGATCT
SNP:
C/G