Resource Type:
Genetic Marker
Name:
MK004670 K2114
Identifier:
MK004670_K2114
Organism:
Marker Type:
SNP
Publication:
- Iorizzo M, Ellison S, Senalik D, Zeng P, Satapoomin P, Huang J, Bowman M, Iovene M, Sanseverino W, Cavagnaro P, Yildiz M, Macko-Podgórni A, Moranska E, Grzebelus E, Grzebelus D, Ashrafi H, Zheng Z, Cheng S, Spooner D, Van Deynze A, Simon P. A high-quality carrot genome assembly provides new insights into carotenoid accumulation and asterid genome evolution.. Nature genetics. 2016 06; 48(6):657-66.
- Cavagnaro PF, Iorizzo M, Yildiz M, Senalik D, Parsons J, Ellison S, Simon PW. A gene-derived SNP-based high resolution linkage map of carrot including the location of QTL conditioning root and leaf anthocyanin pigmentation.. BMC genomics. 2014 Dec 16; 15:1118.
- Parsons J, Matthews W, Iorizzo M, Roberts P, Simon P. Meloidogyne incognita nematode resistance QTL in carrot. Molecular breeding. 2015; 35(5).
- Parsons Joshua D. QTL for Meloidogyne incognita root knot nematode resistance and other traits of interest in carrot (Daucus carota). Ph.D. Thesis. 2014. University of Wisconsin-Madison
Relationship:
| Relationships |
|---|
| The genetic_marker, MK004670 K2114, is adjacent to primer, K2114_X. |
| The genetic_marker, MK004670 K2114, is adjacent to primer, K2114_Y. |
| The genetic_marker, MK004670 K2114, is adjacent to primer, K2114_Common. |
| The genetic_marker, MK004670 K2114, is located in gene, DCAR_016826. |
| The genetic_marker, MK004670 K2114, is located in gene, LOC108222839. |
| The marker_locus, K2114, is an instance of genetic_marker, MK004670 K2114. |
MapViewer Marker Map Positions:
| Map Name | Linkage Group | Position | Locus | MapViewer |
|---|---|---|---|---|
| 2014 J.Parsons Th. SFF×HM2 | Chr5 | 18.275 | K2114 | MapViewer |
| 2016 70796 NG full map | Chr5 | 53.449 | K2114 | MapViewer |
| 2014 J.Parsons Th. Fig_2.4 | Chr5 | 15.314 | K2114 | MapViewer |
| 2016 Integ NG full map | CH5 | 20.961 | K2114 | MapViewer |
| 2014 J.Parsons Th. Fig_4.4 | F2_Chr5 | 13.711 | K2114 | MapViewer |
| 2014 70349 | Chromosome_5 | 48.298 | K2114 | MapViewer |
| 2014 J.Parsons Th. Fig_3.5 | Chr5 | 15.314 | K2114 | MapViewer |
| 2015 MB Merged | Chr5 | 15.314 | K2114 | MapViewer |
| 2016 80592 NG bin map | Chr5 | 12.247 | K2114 | MapViewer |
| 2015 SFF×HM2 | Chr5 | 18.275 | K2114 | MapViewer |
| 2016 80592 NG full map | Chr5 | 12.247 | K2114 | MapViewer |
| 2016 Integ NG bin map | CH5 | 20.584 | K2114 | MapViewer |
| 2014 J.Parsons Th. Br1091×HM1 | Chr5 | 12.247 | K2114 | MapViewer |
| 2016 70349 NG bin map | Chr5 | 48.298 | K2114 | MapViewer |
| 2016 70349 NG full map | Chr5 | 48.298 | K2114 | MapViewer |
| 2015 Br1091×HM1 | Chr5 | 12.247 | K2114 | MapViewer |
Synonyms:
- MK004670
Sequence Coordinates:
DCARv2_Chr5:8018521..8018567+
View location in JBrowse:
Sequence:
GTGGGCATGTGTTCGAAGAAATGCAGAGGCCTGGTACMCCTCTGTACAAC
ATTAAGGCATACCTTCCTGTT
Sequences:
>MK004670_K2114 ID=MK004670_K2114; Name=MK004670 K2114; organism=Daucus carota; type=genetic_marker
GTGGGCATGTGTTCGAAGAAATGCAGAGGCCTGGTACMCCTCTGTACAAC
ATTAAGGCATACCTTCCTGTT
This is the primary representative sequence for this feature.
Sequence Length:
71
Five Prime Flanking Region:
GTGGGCATGTGTTCGAAGAAATGCAGAGGCCTGGTAC
Three Prime Flanking Region:
CCTCTGTACAACATTAAGGCATACCTTCCTGTT
SNP:
A/C